View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8319A_low_140 (Length: 245)
Name: NF8319A_low_140
Description: NF8319A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8319A_low_140 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 18 - 239
Target Start/End: Original strand, 52989716 - 52989937
Alignment:
| Q |
18 |
gacatcacatacctgctcttgtgcttgcattgcagctgattgacaatctccagtgagcatggcggtttttattcccaataacttcaacttccttattgcc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
52989716 |
gacatcacatacctgctcttgtgcttgcattgcagctgattgacaatctccagtgagcatggcagttttgattcccaataacttcaacttccttattgcc |
52989815 |
T |
|
| Q |
118 |
tcctgaactcctgatcggcaagtatcagatagtgagaaaaatccaactggggttggtcctgcgtatatttatccaatgggctttcctccctgagcttcac |
217 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||| |||||||||||||||||||| |||||| |||||||||| ||||||||| |||||||||| |
|
|
| T |
52989816 |
tcctgaactcctgatcgacaagtatcagatagagagaaaattccaactggggttggtcctgagtatatgtatccaatggtctttcctccatgagcttcac |
52989915 |
T |
|
| Q |
218 |
cctcttaggccgggaccactat |
239 |
Q |
| |
|
| ||| ||| || |||||||| |
|
|
| T |
52989916 |
cttctaaggttggaaccactat |
52989937 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University