View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8319A_low_141 (Length: 245)
Name: NF8319A_low_141
Description: NF8319A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8319A_low_141 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 11565499 - 11565736
Alignment:
| Q |
1 |
atgcaagtgcactacaaattgttggaattaaacacttgtttcttctttactcaatcagttatcaatacctattatctatccattcacgtgaaacacaact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11565499 |
atgcaagtgcactacaaattgttggaattaaacacttgtttcttctttactcaatcagttatcaatacctattatctatccattcacgtgaaacacaact |
11565598 |
T |
|
| Q |
101 |
tcttcgacgaacccgaactaccacaacgcagttaatcctctgttccccataactcaccacaatctgcgccatttccgtcgttcatgtctatgcgccattt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
11565599 |
tcttcgacgaacccgaactaccacaacgcagttaatcctctgttccccattactcaccacaatctgcgccatttccgtcgttcatgtctatgcaccattt |
11565698 |
T |
|
| Q |
201 |
cccaccctcgatctaatctctatccgttcatttcactc |
238 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
11565699 |
cccaccctcgatctaatatctatccgttcatttcactc |
11565736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University