View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8319A_low_143 (Length: 245)
Name: NF8319A_low_143
Description: NF8319A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8319A_low_143 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 21 - 227
Target Start/End: Complemental strand, 7899486 - 7899279
Alignment:
| Q |
21 |
atacagctcacgcgtggttgacttgatccgacacatggcttcagttggttaatgtgcaaggagtttttggcatacatctagtgcgatgacacttctatct |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7899486 |
atacagctcacgcgtggttgacttgatccgacacatggcttcagttggttaatgtgcaaggagtttttggcatacatctagtgcaatgacacttctatct |
7899387 |
T |
|
| Q |
121 |
tacaaatcaagcattcagtaaagtaga-ttttggaataattttgcttctgttaaatgacgagaatattgttccacacaacttaattcatgtcttcaagct |
219 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
7899386 |
tacaaatcaagcattcagtaaagtagatttttggaataattttgcttctgttaaatgacgagaatattgttccacacaacttaattcatgtgttcaagct |
7899287 |
T |
|
| Q |
220 |
tctatatt |
227 |
Q |
| |
|
|||||||| |
|
|
| T |
7899286 |
tctatatt |
7899279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University