View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8319A_low_144 (Length: 244)
Name: NF8319A_low_144
Description: NF8319A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8319A_low_144 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 231; Significance: 1e-128; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 231; E-Value: 1e-128
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 34899926 - 34899696
Alignment:
| Q |
1 |
acacatctctctttagttcttctctcgctatttgatgtcaacaaaagctaaattgtgtcttcccctgcgtgtatgcaaccttatagtctcaaaattttcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899926 |
acacatctctctttagttcttctctcgctatttgatgtcaacaaaagctaaattgtgtcttcccctgcgtgtatgcaaccttatagtctcaaaattttcc |
34899827 |
T |
 |
| Q |
101 |
ttccattctcaccaaacatgaaaggtatgtatcttccaactacaaaattttatgtgaatttgtgcagatgatatcactgacaatatgataatttggtatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899826 |
ttccattctcaccaaacatgaaaggtatgtatcttccaactacaaaattttatgtgaatttgtgcagatgatatcactgacaatatgataatttggtatc |
34899727 |
T |
 |
| Q |
201 |
tcttgcctatcttattataacatttgcatat |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
34899726 |
tcttgcctatcttattataacatttgcatat |
34899696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University