View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8319A_low_152 (Length: 242)
Name: NF8319A_low_152
Description: NF8319A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8319A_low_152 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 22 - 236
Target Start/End: Original strand, 34444044 - 34444258
Alignment:
| Q |
22 |
ttatctccgcgttggaacttagaccagttgatagttctatttataaaactgagttcggtgattctgcttcattgttacttttcaaaagatgggacattgg |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34444044 |
ttatctccgcgttggaacttagaccagttgatagttctatttataaaactgagttcggtgattctgcttcattgttacttttcaaaagatgggacattgg |
34444143 |
T |
|
| Q |
122 |
ttcatttaatggaagtggtagatatcaagacgatgtttacgatagaatttggtttcctttgaattcctcttcatggaaatctataaacacttcttcaaaa |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34444144 |
ttcatttaatggaagtggtagatatcaagacgatgtttacgatagaatttggtttcctttgaattcctcttcatggaaatctataaacacttcttcaaaa |
34444243 |
T |
|
| Q |
222 |
attgatattattgga |
236 |
Q |
| |
|
|||||| ||| |||| |
|
|
| T |
34444244 |
attgatgttagtgga |
34444258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 22 - 236
Target Start/End: Original strand, 34437297 - 34437511
Alignment:
| Q |
22 |
ttatctccgcgttggaacttagaccagttgatagttctatttataaaactgagttcggtgattctgcttcattgttacttttcaaaagatgggacattgg |
121 |
Q |
| |
|
||||||| || ||||||||||||||| |||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34437297 |
ttatctcagcattggaacttagaccaattgataactctatttataaaactgagtttggtgattctgcttcattgttacttttcaaaagatgggacattgg |
34437396 |
T |
|
| Q |
122 |
ttcatttaatggaagtggtagatatcaagacgatgtttacgatagaatttggtttcctttgaattcctcttcatggaaatctataaacacttcttcaaaa |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |||||||||||||||||| | || |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
34437397 |
ttcatttaatggaagtggtagatatcaagatgatgtttatgatagaatttggtttcctcttaaatcctcttcatggaaatctataagcacttcttcaaaa |
34437496 |
T |
|
| Q |
222 |
attgatattattgga |
236 |
Q |
| |
|
|| ||| ||| |||| |
|
|
| T |
34437497 |
atagatgttagtgga |
34437511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University