View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8319A_low_156 (Length: 241)
Name: NF8319A_low_156
Description: NF8319A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8319A_low_156 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 19 - 189
Target Start/End: Complemental strand, 20427209 - 20427047
Alignment:
| Q |
19 |
gaagaaagctatttctccctcaacaaatccacaaccacttccgccaatgctctctgaagacatggaattacaagttgtccctgctgatgtcaaagctgta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
20427209 |
gaagaaagctatttctccctcaacaaatccacaaccacttccgccaatgctctctgaagacatggaattacaagttgtccct------------gctgta |
20427122 |
T |
 |
| Q |
119 |
cgcaacactact----gatggtgttgctgaggtcctcattcaatggaaagaccttcccgaatttgaagctacttg |
189 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20427121 |
cgcaacactactgatggatggtgttgctgaggtcctcattcaatggaaagaccttcccgaatttgaagctacttg |
20427047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University