View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8319A_low_169 (Length: 235)
Name: NF8319A_low_169
Description: NF8319A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8319A_low_169 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 32103476 - 32103698
Alignment:
| Q |
1 |
atatagtgagtgaggaagaggaaaagaaaatgatgacgtacagttgttgtgggcaaagttgccagaagaggctataagtccactgaacagattgcaccgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32103476 |
atatagtgagtgaggaagaggaaaagaaaatgatgacgtacagttgttgtgggcaaagttgccagaagaggctataagtccactgaacagattgcaccgc |
32103575 |
T |
|
| Q |
101 |
agcctgcaacatgttttgaagcttactgcctaatggagatggagccgccattctttattcattcagtcattaccaaacagttttttctttcatttctctg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32103576 |
agcctgcaacatgttttgaagcttactgcctaatggagatggagcagccattctttattcattcagtcattaccaaacagttttttctttcatttctctg |
32103675 |
T |
|
| Q |
201 |
caatatttaatcatatctaaaac |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
32103676 |
caatatttaatcatatctaaaac |
32103698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University