View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8319A_low_185 (Length: 229)
Name: NF8319A_low_185
Description: NF8319A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8319A_low_185 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 7 - 229
Target Start/End: Complemental strand, 35450052 - 35449830
Alignment:
| Q |
7 |
tttggtgttagtacttcaatcattgattgatcaataattggtgaagaaacaatgctttcttcacaatctgatgaagacaaagaaaaaccattgtttgagt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
35450052 |
tttggtgttagtacttcaatcattgattgatcaataattggtgaagaaacaatgctttcttcacaatctgaagaagacaaagaaaaaccattgtttgagt |
35449953 |
T |
|
| Q |
107 |
caattccttttcttgtaacttgttcatcttcaatgcttgaaactccggaaagtggagcattttgttgttgatgtaaaactagcttttcaaagagaagtct |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
35449952 |
caattccttttcttgtaacttgttcatcttcaatgcttgaaactccggaaagtggatcattttgttgttgatggaaaactagcttttccaagagaagtct |
35449853 |
T |
|
| Q |
207 |
ttcacatttttcttgtgcttcat |
229 |
Q |
| |
|
|| |||||||||||||||||||| |
|
|
| T |
35449852 |
ttgacatttttcttgtgcttcat |
35449830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University