View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8319A_low_203 (Length: 225)
Name: NF8319A_low_203
Description: NF8319A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8319A_low_203 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 109; Significance: 5e-55; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 10 - 126
Target Start/End: Original strand, 41760537 - 41760653
Alignment:
| Q |
10 |
gtcgaagaatatattgaaaatataattttcatagacgaagaacaaggagaagaagttgaactatttgatgcacatgatgacgagggagataaattgtcgg |
109 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
41760537 |
gtcgaagaaaatattgaaaatataattttcatagacgaagaacaaggagaagaagttgaactatttgatgcacatgatgatgagggagataaattgtcgg |
41760636 |
T |
 |
| Q |
110 |
aaattgattacattcta |
126 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
41760637 |
aaattgattacattcta |
41760653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 57 - 126
Target Start/End: Original strand, 41795385 - 41795454
Alignment:
| Q |
57 |
agaagaagttgaactatttgatgcacatgatgacgagggagataaattgtcggaaattgattacattcta |
126 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| || ||||||||| |||||||||||||||||||||| |
|
|
| T |
41795385 |
agaagaagttgaactatttgatgcagatgatgaagacggagataaagggtcggaaattgattacattcta |
41795454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University