View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8319A_low_213 (Length: 218)
Name: NF8319A_low_213
Description: NF8319A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8319A_low_213 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 96 - 198
Target Start/End: Complemental strand, 18518553 - 18518451
Alignment:
| Q |
96 |
atggcacttccttcattgaaaccatacaaccttaaaaacccaacatcaaccttaattcaatcatggtcatgttctcataaaccaaacactcttactcttg |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18518553 |
atggcacttccttcattgaaaccatacaaccttaaaaacccaacatcaaccttaattcaatcatggtcatgttctcataaaccaaacactcttactcttg |
18518454 |
T |
|
| Q |
196 |
tct |
198 |
Q |
| |
|
||| |
|
|
| T |
18518453 |
tct |
18518451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University