View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8319A_low_217 (Length: 215)
Name: NF8319A_low_217
Description: NF8319A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8319A_low_217 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 16 - 196
Target Start/End: Original strand, 6307197 - 6307377
Alignment:
| Q |
16 |
aacaatatctaaccgcacaaaactgtttctcattagagttcaatgaacttggctaagtaatgataaaaagttatacatattttcaaacccccgtgcacat |
115 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
6307197 |
aacaatatctaactgcacaaaactgtttctcattagagttcaatgaacttggctaagtaatgataaaaagttatacatactttcaaacccccgtgcacat |
6307296 |
T |
|
| Q |
116 |
ctttcactcattttgttcttggatcatgtatacctataaaattgcagacaaagaaatcaacttcttacctttcctgtactt |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6307297 |
ctttcactcattttgttcttggatcatgtatacctataaaattgcagacaaagaaatcaacttcttacctttcctgtactt |
6307377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University