View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8319A_low_218 (Length: 214)
Name: NF8319A_low_218
Description: NF8319A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8319A_low_218 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 65 - 187
Target Start/End: Original strand, 39065855 - 39065977
Alignment:
| Q |
65 |
taattagtacattttggtaccccaaagtccagttagttagtaagaagatgaacaaaaccctaaccatttttataatgattgcatttgtgcatgcgcgtag |
164 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39065855 |
taattagttcattttggtaccccaaagtccagttagttagtaagaagatgaacaaaaccctaaccatttttataatgattgcatttgtgcatgcgcgtag |
39065954 |
T |
 |
| Q |
165 |
aacaacataacagggagtagtac |
187 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
39065955 |
aacaacataacagggagtagtac |
39065977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University