View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8319A_low_228 (Length: 209)
Name: NF8319A_low_228
Description: NF8319A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8319A_low_228 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-103
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 17801063 - 17801271
Alignment:
| Q |
1 |
tcaccggagcgtgagcacattgatgtggaagttacggaaaccattgccgttgtgaatcataacggcgatgtgacagggcccgttttctgtcccagtcctg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||| ||||| ||||||||||||||||| | |
|
|
| T |
17801063 |
tcaccggagcgtgagcacattgatgtggaagtaacggaaaccattgctgttgtgaatcataacggcgatgtgactgggcctgttttctgtcccagtccag |
17801162 |
T |
|
| Q |
101 |
acgtgaatgcgaaagctgcaacattcattgctcgtcttaggggtgaatggaggctacaaaaacttaactccatcaaggagaaaggcaatggctcattgcc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17801163 |
acgtgaatgcgaaagctgcaacattcattgctcgtcttaggggtgaatggaggctacaaaaacttaactccatcaaggagaaaggcaatggctcattgcc |
17801262 |
T |
|
| Q |
201 |
tcatgcaag |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
17801263 |
tcatgcaag |
17801271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University