View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8319A_low_233 (Length: 208)
Name: NF8319A_low_233
Description: NF8319A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8319A_low_233 |
 | |
|
| [»] scaffold0191 (1 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 41 - 190
Target Start/End: Original strand, 929746 - 929895
Alignment:
| Q |
41 |
aaccattttaatatgcgacactatgccgcttacattcattgagtttccttcaaagataatttgatttctacctagcaaaatgcattagattgtatccatc |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
929746 |
aaccattttaatatgcgacactatgccgcttacattcattgagtttccttcaaagataatttgatttctacctagaaaaatgcattagattgtatccatc |
929845 |
T |
|
| Q |
141 |
catacacgataaatgtgagaatttcctacctttcttcccacctttgatac |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
929846 |
catacacgataaatgtgagaatttcctacctttcttaccacctttgatac |
929895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0191 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0191
Description:
Target: scaffold0191; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 150 - 190
Target Start/End: Complemental strand, 24981 - 24941
Alignment:
| Q |
150 |
taaatgtgagaatttcctacctttcttcccacctttgatac |
190 |
Q |
| |
|
|||||||||| |||||||| ||||||| ||||||||||||| |
|
|
| T |
24981 |
taaatgtgagcatttcctatctttcttaccacctttgatac |
24941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University