View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8319_high_18 (Length: 256)

Name: NF8319_high_18
Description: NF8319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8319_high_18
NF8319_high_18
[»] chr7 (1 HSPs)
chr7 (1-124)||(517349-517472)


Alignment Details
Target: chr7 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 1 - 124
Target Start/End: Original strand, 517349 - 517472
Alignment:
1 atgatttcaaaactgatttagctagttcttcgatgttattacataagttaatctctgcagtaaataataatgatcaactaaaagcacagtcttagcattg 100  Q
    |||||||||||| |||||||||||||||||| |||||||||| ||||||||| |||||| ||||||| ||||||||||||||||||||||||||||||||    
517349 atgatttcaaaattgatttagctagttcttcaatgttattacgtaagttaatgtctgcaataaataacaatgatcaactaaaagcacagtcttagcattg 517448  T
101 tcaatcgtgttggggatttatgtt 124  Q
    ||||||||||||||||||||||||    
517449 tcaatcgtgttggggatttatgtt 517472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University