View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8319_high_22 (Length: 237)

Name: NF8319_high_22
Description: NF8319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8319_high_22
NF8319_high_22
[»] chr3 (1 HSPs)
chr3 (17-95)||(4603354-4603432)


Alignment Details
Target: chr3 (Bit Score: 67; Significance: 7e-30; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 17 - 95
Target Start/End: Complemental strand, 4603432 - 4603354
Alignment:
17 atgaagttaggaatcacaagagatgaatatgtttccaatcccacacatttcaatctcaaagctatcttcaagtaaaact 95  Q
    |||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| ||||||||||    
4603432 atgaagttaggaatcacaagagatgaatatgtttccaatccctcacttttcaatctcaaagctatcttaaagtaaaact 4603354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University