View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8319_high_24 (Length: 231)
Name: NF8319_high_24
Description: NF8319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8319_high_24 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 24 - 213
Target Start/End: Complemental strand, 37058647 - 37058458
Alignment:
| Q |
24 |
ataagggcttaagttacctgagagtccgaagcctgaaaggtccaagctagtcactctttggttatgcttgtcacataggacaccagtccaattgcaagga |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37058647 |
ataagggcttaagttacctgagagtccgaagcctgaaaggtccaagctagtcactctttggttatgcttgtcacataggacaccagtccaattgcaagga |
37058548 |
T |
|
| Q |
124 |
gatgaattatggatccaagaggataatgggggaggagaagtgttattattgcttaactgagattttaatgagattaaggcttctttgtct |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
37058547 |
gatgaattatggatccaagaggataatgggggaggagaagtgttattattgcttaactgagattttaataagattaaggcttctttgtct |
37058458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 24 - 213
Target Start/End: Complemental strand, 37066125 - 37065936
Alignment:
| Q |
24 |
ataagggcttaagttacctgagagtccgaagcctgaaaggtccaagctagtcactctttggttatgcttgtcacataggacaccagtccaattgcaagga |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37066125 |
ataagggcttaagttacctgagagtccgaagcctgaaaggtccaagctagtcactctttggttatgcttgtcacataggacaccagtccaattgcaagga |
37066026 |
T |
|
| Q |
124 |
gatgaattatggatccaagaggataatgggggaggagaagtgttattattgcttaactgagattttaatgagattaaggcttctttgtct |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
37066025 |
gatgaattatggatccaagaggataatgggggaggagaagtgttattattgcttaactgagattttaataagattaaggcttctttgtct |
37065936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University