View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8319_low_17 (Length: 330)
Name: NF8319_low_17
Description: NF8319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8319_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 17 - 321
Target Start/End: Original strand, 14960443 - 14960747
Alignment:
| Q |
17 |
agtaagtatgttcatgttcatcttattggtgataatgcaaatccatgactcnnnnnnnnaagttatttgagagatttggttaattttcgatattgacatc |
116 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
14960443 |
agtaagtatgttcatgttcatcttaatggtgataatgcaaatccatgactcttttttttaagttatttgagagatttggttaattttcaatattgacatc |
14960542 |
T |
|
| Q |
117 |
ctaattataatccgtatttttgtaggatttcatgtccgaagatacgatattttgtggtgtcttcgatggtcatggtccacaaggtcatctggttgcgcgt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14960543 |
ctaattataatccgtatttttgtaggatttcatgtccgaagatacgatattttgtggtgtcttcgatggtcatggtccacaaggtcatctggttgcgcgt |
14960642 |
T |
|
| Q |
217 |
aaagtgagggatacattgccagtaaaattactttcattttggcattctcttgaatcgaaacaaaataggtcagacaaaacttgcttcaaacggaatataa |
316 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
14960643 |
aaagtgagggatacattgccagtaaaattgctttcattttggcattctcttgaatcgaaacaaaataggtcagacaaaacttgcttcaaacggaacataa |
14960742 |
T |
|
| Q |
317 |
cacca |
321 |
Q |
| |
|
||||| |
|
|
| T |
14960743 |
cacca |
14960747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 139 - 256
Target Start/End: Complemental strand, 38270581 - 38270464
Alignment:
| Q |
139 |
taggatttcatgtccgaagatacgatattttgtggtgtcttcgatggtcatggtccacaaggtcatctggttgcgcgtaaagtgagggatacattgccag |
238 |
Q |
| |
|
|||||||| |||| |||||| |||| || |||||||| || ||||| ||||||||| | ||||| || || ||||||||||| |||||| | ||||| |
|
|
| T |
38270581 |
taggattttgtgtcagaagatgcgatcttctgtggtgtgtttgatggccatggtccatacggtcacctagtagcgcgtaaagttagggatgccttgccca |
38270482 |
T |
|
| Q |
239 |
taaaattactttcatttt |
256 |
Q |
| |
|
||||||| |||||||||| |
|
|
| T |
38270481 |
taaaattgctttcatttt |
38270464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University