View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8319_low_19 (Length: 294)
Name: NF8319_low_19
Description: NF8319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8319_low_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 18 - 266
Target Start/End: Original strand, 27660964 - 27661211
Alignment:
| Q |
18 |
agattattctatgaagcacaagatatattatctttgctataaaaaataacgtgtgtttataccaaatagagaaaataaaataaagtgtattgatcgtatg |
117 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
27660964 |
agattattctatgaagcataagaaatattatctttgctataaaaaataaagtgt--ttataccaaatagagaaaataaaataaagtgtactgatcgtatg |
27661061 |
T |
|
| Q |
118 |
caacgatctgccgaatttctgaaataatatataggcttaaataaataaaatatctctctaagttagcgtgtttttcgttttaatcatgtatc-nnnnnnn |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
27661062 |
taacgatctgccgaatttctgaaataatatataggcttaaataagtaaaatatctctataagttagcgtgtttttcgttttaatcatgtatctttttttt |
27661161 |
T |
|
| Q |
217 |
gttgcgaaacaacatttatatttacttaattttttgaaattgatctctgc |
266 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
27661162 |
gttgcgaaacaacctttgtatttacttaattttttgaaattggtctctgc |
27661211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 150 - 199
Target Start/End: Complemental strand, 33489959 - 33489910
Alignment:
| Q |
150 |
aggcttaaataaataaaatatctctctaagttagcgtgtttttcgtttta |
199 |
Q |
| |
|
|||||||||||| |||||| || || |||||||||| ||||||||||||| |
|
|
| T |
33489959 |
aggcttaaataagtaaaatgtccctgtaagttagcgcgtttttcgtttta |
33489910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University