View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8319_low_21 (Length: 256)
Name: NF8319_low_21
Description: NF8319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8319_low_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 1 - 124
Target Start/End: Original strand, 517349 - 517472
Alignment:
| Q |
1 |
atgatttcaaaactgatttagctagttcttcgatgttattacataagttaatctctgcagtaaataataatgatcaactaaaagcacagtcttagcattg |
100 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |||||||||| ||||||||| |||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
517349 |
atgatttcaaaattgatttagctagttcttcaatgttattacgtaagttaatgtctgcaataaataacaatgatcaactaaaagcacagtcttagcattg |
517448 |
T |
 |
| Q |
101 |
tcaatcgtgttggggatttatgtt |
124 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
517449 |
tcaatcgtgttggggatttatgtt |
517472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University