View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8319_low_5 (Length: 480)
Name: NF8319_low_5
Description: NF8319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8319_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 351; Significance: 0; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 351; E-Value: 0
Query Start/End: Original strand, 16 - 370
Target Start/End: Original strand, 44200703 - 44201057
Alignment:
| Q |
16 |
gttgttaccagaagaaatcttgactaagaatgccatcttttgaatcagcatcggtagcatcattggtaaccctaatggaaggattttgatttgcctctga |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44200703 |
gttgttaccagaagaaatcttgactaagaatgccatcttttgaatcagcatcggtagcatcattggtaaccctaatggaaggattttgatttgcctctga |
44200802 |
T |
|
| Q |
116 |
atcgataaggttctggaagtgagaaagggcggaagaagttatagttgttgttggtaacggtttgtattgtttgagagagaatttgctgagctgaagctgt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44200803 |
atcgataaggttctggaagtgagaaagggcggaagaagttatagttgttgttggtaacggtttgtattgtttgagagagaatttgctgagctgaagctgt |
44200902 |
T |
|
| Q |
216 |
aactgtcttgtgttactcgcaccgagtggtgccttcttccttccccttgattttggggtttttctcgtcattttcaaatctttgaatcttcgattcaaga |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44200903 |
aactgtcttgtgttactcgcaccgagtggtgcctttttccttccccttgattttggggtttttctcgtcattttcaaatctttgaatcttcgattcaaga |
44201002 |
T |
|
| Q |
316 |
ccagtgaagaagatgaagaataatggtagtagtgtgtttggtctttcagaacagt |
370 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44201003 |
ccagtgaagaagatgaagaataatggtagtagtgtgtttggtctttcagaacagt |
44201057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 412 - 464
Target Start/End: Original strand, 44201112 - 44201164
Alignment:
| Q |
412 |
tgttattattatttgggtacggggaagcggaaattattcaaaaaatgcgcggg |
464 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44201112 |
tgttattattatttgggtacggggaagcggaaattattcaaaaaatgcgcggg |
44201164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University