View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8320_high_5 (Length: 271)
Name: NF8320_high_5
Description: NF8320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8320_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 10 - 218
Target Start/End: Original strand, 1256899 - 1257107
Alignment:
| Q |
10 |
acatcaacaacaattttacacataatataatgctatgtaaaataattcatacaaaaaatttcatataaacatatatgttaatcaatctatgtcaaatcta |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1256899 |
acatcaacaacaattttacacataatataatgctatgtaaaataattcatacaaaaaatttcatataaacatatatgttaatcaatctatgtcaaatcta |
1256998 |
T |
 |
| Q |
110 |
caacaaataaagtatcatcatccaccttatatttacgttgactcccttgctccaattcaaaacgcttccaagcaaccccagagccaaatatatcagggcc |
209 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||| |||| |
|
|
| T |
1256999 |
caacaaatacagtatcatcatccaccttatatttacgttgactcccttgctccaattcaaaacgcttccaagcaatcccagagccaaaaatatcacggcc |
1257098 |
T |
 |
| Q |
210 |
aatagaggg |
218 |
Q |
| |
|
|||||||| |
|
|
| T |
1257099 |
tatagaggg |
1257107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University