View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8323_high_3 (Length: 202)
Name: NF8323_high_3
Description: NF8323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8323_high_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 12 - 189
Target Start/End: Original strand, 36598961 - 36599138
Alignment:
| Q |
12 |
attatactccttgcacattttgtgcctcctattgtttcatttgaacaaggtaagtgcaaaggttccggcaataatcgtgttcggagactcttctgttgat |
111 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
36598961 |
attatgctccttgcacattttgtgcctcctattgtttcatttgaacaaggtaagtgcaaaggttccggcaataatcgtgttcggagactcttccgttgat |
36599060 |
T |
|
| Q |
112 |
gccgggaataacaacttcattccgacggttgcacggagcaattttcagccgtacggacgtgactttcaaggtggaaaa |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
36599061 |
gccgggaataacaacttcattccgacggttgcacggagcaattttcagccgtatggacgtgactttcaaggcggaaaa |
36599138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 55; Significance: 8e-23; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 64 - 178
Target Start/End: Complemental strand, 37385684 - 37385570
Alignment:
| Q |
64 |
agtgcaaaggttccggcaataatcgtgttcggagactcttctgttgatgccgggaataacaacttcattccgacggttgcacggagcaattttcagccgt |
163 |
Q |
| |
|
||||| ||||||||||| || || |||||||| ||||| || || ||||||||||| ||||||||||| |||||||||| ||||||||||| ||||||| |
|
|
| T |
37385684 |
agtgctaaggttccggcgatcatagtgttcggcgactcatccgtggatgccgggaacaacaacttcatatcgacggttgctcggagcaatttccagccgt |
37385585 |
T |
|
| Q |
164 |
acggacgtgactttc |
178 |
Q |
| |
|
| |||||||| |||| |
|
|
| T |
37385584 |
atggacgtgattttc |
37385570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University