View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8323_low_3 (Length: 286)
Name: NF8323_low_3
Description: NF8323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8323_low_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 18 - 267
Target Start/End: Complemental strand, 24860878 - 24860628
Alignment:
| Q |
18 |
ttaagttttttcaaagggtcttagttttcaactagaactaaaagttcattcatgacttcatgtaattnnnnnnnctatgtaaatccttgta-tgatgaag |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
24860878 |
ttaagttttttcaaagggtcttagttttcaactagaactaaaagttcattcatgacttcatgtaattaaaaaaactatgtaaatccttgtactgatgaag |
24860779 |
T |
|
| Q |
117 |
gaggggtaatttatttacttattgtttgataaaacatgtattaaataaattaatagagtgcatcgtaatggttatcaaagagatttttgtttcttttacc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24860778 |
gaggggtaatttatttacttattgtttgataaaacatgtattaaattaattaatagagtgcatcgtaatggttatcaaagagatttttgtttcttttacc |
24860679 |
T |
|
| Q |
217 |
gattgatcgtcgaatatatatgattagactttccgctcacacttattatga |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
24860678 |
gattgatcgtcgaatatatatgattagactttctgctcacactcattatga |
24860628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University