View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8324_1D_high_13 (Length: 235)

Name: NF8324_1D_high_13
Description: NF8324_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8324_1D_high_13
NF8324_1D_high_13
[»] chr2 (2 HSPs)
chr2 (78-211)||(19149066-19149199)
chr2 (7-52)||(42667660-42667705)
[»] chr7 (1 HSPs)
chr7 (78-209)||(19430103-19430240)


Alignment Details
Target: chr2 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 78 - 211
Target Start/End: Complemental strand, 19149199 - 19149066
Alignment:
78 ggaagaacaagcaaccttgaaccagacgaccatgattgtggtgaggtatgttgagagaggagatgaatgaaagagatgaaagagacagagtgaagtcaaa 177  Q
    ||||||||||||||||||||||||||| ||| |||| ||||||||||||||||||||||||| |||||||||||||||||||||| | ||||||||||||    
19149199 ggaagaacaagcaaccttgaaccagacaaccgtgatggtggtgaggtatgttgagagaggaggtgaatgaaagagatgaaagagagacagtgaagtcaaa 19149100  T
178 aaagttgaattttttattttagtgggacccacat 211  Q
    ||||||||||||||||||||||||||||||||||    
19149099 aaagttgaattttttattttagtgggacccacat 19149066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 7 - 52
Target Start/End: Complemental strand, 42667705 - 42667660
Alignment:
7 atgaacagtggcgatttagcgatgatactcatgttaaccgttatcg 52  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
42667705 atgaacagtggcgatttagcgatgatactcatgttaaccgttatcg 42667660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 78 - 209
Target Start/End: Complemental strand, 19430240 - 19430103
Alignment:
78 ggaagaacaagcaaccttgaaccagacgaccatgattgtggtgaggtatgtt--gagagaggagatgaatgaaagagatgaaagagacagagtga----- 170  Q
    |||| ||||||||||||||||||| || ||| |||| |||||||||||| ||  |||||||||| ||||||||| ||||| |||||| |||||||         
19430240 ggaataacaagcaaccttgaaccaaacaaccgtgatggtggtgaggtatcttgagagagaggaggtgaatgaaaaagatggaagagagagagtgagtgag 19430141  T
171 agtcaaaaaagttgaattttttattttagtgggacccac 209  Q
    |||||||||||||| | ||||||||||||||||||||||    
19430140 agtcaaaaaagttg-agtttttattttagtgggacccac 19430103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University