View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8324_1D_high_13 (Length: 235)
Name: NF8324_1D_high_13
Description: NF8324_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8324_1D_high_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 78 - 211
Target Start/End: Complemental strand, 19149199 - 19149066
Alignment:
| Q |
78 |
ggaagaacaagcaaccttgaaccagacgaccatgattgtggtgaggtatgttgagagaggagatgaatgaaagagatgaaagagacagagtgaagtcaaa |
177 |
Q |
| |
|
||||||||||||||||||||||||||| ||| |||| ||||||||||||||||||||||||| |||||||||||||||||||||| | |||||||||||| |
|
|
| T |
19149199 |
ggaagaacaagcaaccttgaaccagacaaccgtgatggtggtgaggtatgttgagagaggaggtgaatgaaagagatgaaagagagacagtgaagtcaaa |
19149100 |
T |
 |
| Q |
178 |
aaagttgaattttttattttagtgggacccacat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
19149099 |
aaagttgaattttttattttagtgggacccacat |
19149066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 7 - 52
Target Start/End: Complemental strand, 42667705 - 42667660
Alignment:
| Q |
7 |
atgaacagtggcgatttagcgatgatactcatgttaaccgttatcg |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42667705 |
atgaacagtggcgatttagcgatgatactcatgttaaccgttatcg |
42667660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 78 - 209
Target Start/End: Complemental strand, 19430240 - 19430103
Alignment:
| Q |
78 |
ggaagaacaagcaaccttgaaccagacgaccatgattgtggtgaggtatgtt--gagagaggagatgaatgaaagagatgaaagagacagagtga----- |
170 |
Q |
| |
|
|||| ||||||||||||||||||| || ||| |||| |||||||||||| || |||||||||| ||||||||| ||||| |||||| ||||||| |
|
|
| T |
19430240 |
ggaataacaagcaaccttgaaccaaacaaccgtgatggtggtgaggtatcttgagagagaggaggtgaatgaaaaagatggaagagagagagtgagtgag |
19430141 |
T |
 |
| Q |
171 |
agtcaaaaaagttgaattttttattttagtgggacccac |
209 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
19430140 |
agtcaaaaaagttg-agtttttattttagtgggacccac |
19430103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University