View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8324_1D_high_15 (Length: 201)
Name: NF8324_1D_high_15
Description: NF8324_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8324_1D_high_15 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 5 - 171
Target Start/End: Complemental strand, 23010984 - 23010818
Alignment:
| Q |
5 |
agtttggtgttattcttgtactttttgcaagagaggattctctaatgcacaagcattaggaggccacatgaatatccatagaagagatagagccaagctc |
104 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23010984 |
agttaggtcttattcttgtactttttgcaagagaggattctctaatgcacaagcattaggaggccacatgaatatccatagaagagatagagccaagctc |
23010885 |
T |
|
| Q |
105 |
aaacaacaatcttccgaagaaaatttgctttctttggacatcgcaaacaaaaaccctaatgatcaag |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23010884 |
aaacaacaatcttccgaagaaaatttgctttctttggacatcgcaaacaaaaaccctaatgatcaag |
23010818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 53; Significance: 1e-21; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 26 - 118
Target Start/End: Complemental strand, 24223726 - 24223634
Alignment:
| Q |
26 |
tttttgcaagagaggattctctaatgcacaagcattaggaggccacatgaatatccatagaagagatagagccaagctcaaacaacaatcttc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | || || ||||||||||| ||||| | ||||| ||| |||||||||||||||||||| |
|
|
| T |
24223726 |
tttttgcaagagaggattctctaatgcacaagctcttggtggacacatgaatattcataggaaagataaagcaaagctcaaacaacaatcttc |
24223634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 27 - 97
Target Start/End: Original strand, 33406374 - 33406444
Alignment:
| Q |
27 |
ttttgcaagagaggattctctaatgcacaagcattaggaggccacatgaatatccatagaagagatagagc |
97 |
Q |
| |
|
|||||||| ||||||||| | ||||||||||| ||||| || ||||||||||| ||||| | ||||||||| |
|
|
| T |
33406374 |
ttttgcaaaagaggattcacaaatgcacaagctttaggtggtcacatgaatattcataggaaagatagagc |
33406444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 54 - 110
Target Start/End: Complemental strand, 30726662 - 30726606
Alignment:
| Q |
54 |
caagcattaggaggccacatgaatatccatagaagagatagagccaagctcaaacaa |
110 |
Q |
| |
|
||||| ||||| || ||||||||| | ||||||||||||||||| |||||||||||| |
|
|
| T |
30726662 |
caagctttaggtggtcacatgaatgttcatagaagagatagagctaagctcaaacaa |
30726606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University