View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8324_1D_low_25 (Length: 246)

Name: NF8324_1D_low_25
Description: NF8324_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8324_1D_low_25
NF8324_1D_low_25
[»] chr1 (1 HSPs)
chr1 (26-155)||(2480513-2480642)
[»] chr4 (2 HSPs)
chr4 (70-155)||(2428636-2428721)
chr4 (71-155)||(47101311-47101395)
[»] chr3 (1 HSPs)
chr3 (70-155)||(49532591-49532676)


Alignment Details
Target: chr1 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 26 - 155
Target Start/End: Original strand, 2480513 - 2480642
Alignment:
26 tttggtgttagggaattggcatcttcagtttgatcctttggtatagggaaattggttttggcattttttccattcatcaatatggctgcttgatcatatg 125  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
2480513 tttggtgttagggaattggcatcttcagtttgatcctttggtatagggaaattggttttggcattttttccattcatcaatatggccgcttgatcatatg 2480612  T
126 ctctggctgcagcctctgctgtctcaaatg 155  Q
    ||||||||||||||||||||||||||||||    
2480613 ctctggctgcagcctctgctgtctcaaatg 2480642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 70 - 155
Target Start/End: Original strand, 2428636 - 2428721
Alignment:
70 agggaaattggttttggcattttttccattcatcaatatggctgcttgatcatatgctctggctgcagcctctgctgtctcaaatg 155  Q
    ||||||||| ||||| |||||| ||||| |||| |  |||||||||| |||||||||||| |||||  | || |||||||||||||    
2428636 agggaaatttgtttttgcatttcttccactcattagaatggctgcttcatcatatgctctagctgcttcttcagctgtctcaaatg 2428721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 71 - 155
Target Start/End: Original strand, 47101311 - 47101395
Alignment:
71 gggaaattggttttggcattttttccattcatcaatatggctgcttgatcatatgctctggctgcagcctctgctgtctcaaatg 155  Q
    |||||||| |||||||||||| | ||| |||| || || || ||||||||||||||||| |||||  | |||||||| |||||||    
47101311 gggaaatttgttttggcatttctaccactcattaaaatcgcagcttgatcatatgctcttgctgcttcttctgctgtttcaaatg 47101395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 70 - 155
Target Start/End: Complemental strand, 49532676 - 49532591
Alignment:
70 agggaaattggttttggcattttttccattcatcaatatggctgcttgatcatatgctctggctgcagcctctgctgtctcaaatg 155  Q
    ||||||||| || || ||| |||  ||||||||||| || || ||||||||||||||||| ||||| || ||||| ||||||||||    
49532676 agggaaattagtctttgcactttgaccattcatcaaaattgcagcttgatcatatgctcttgctgctgcttctgccgtctcaaatg 49532591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University