View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8324_1D_low_25 (Length: 246)
Name: NF8324_1D_low_25
Description: NF8324_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8324_1D_low_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 26 - 155
Target Start/End: Original strand, 2480513 - 2480642
Alignment:
| Q |
26 |
tttggtgttagggaattggcatcttcagtttgatcctttggtatagggaaattggttttggcattttttccattcatcaatatggctgcttgatcatatg |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2480513 |
tttggtgttagggaattggcatcttcagtttgatcctttggtatagggaaattggttttggcattttttccattcatcaatatggccgcttgatcatatg |
2480612 |
T |
 |
| Q |
126 |
ctctggctgcagcctctgctgtctcaaatg |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
2480613 |
ctctggctgcagcctctgctgtctcaaatg |
2480642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 70 - 155
Target Start/End: Original strand, 2428636 - 2428721
Alignment:
| Q |
70 |
agggaaattggttttggcattttttccattcatcaatatggctgcttgatcatatgctctggctgcagcctctgctgtctcaaatg |
155 |
Q |
| |
|
||||||||| ||||| |||||| ||||| |||| | |||||||||| |||||||||||| ||||| | || ||||||||||||| |
|
|
| T |
2428636 |
agggaaatttgtttttgcatttcttccactcattagaatggctgcttcatcatatgctctagctgcttcttcagctgtctcaaatg |
2428721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 71 - 155
Target Start/End: Original strand, 47101311 - 47101395
Alignment:
| Q |
71 |
gggaaattggttttggcattttttccattcatcaatatggctgcttgatcatatgctctggctgcagcctctgctgtctcaaatg |
155 |
Q |
| |
|
|||||||| |||||||||||| | ||| |||| || || || ||||||||||||||||| ||||| | |||||||| ||||||| |
|
|
| T |
47101311 |
gggaaatttgttttggcatttctaccactcattaaaatcgcagcttgatcatatgctcttgctgcttcttctgctgtttcaaatg |
47101395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 70 - 155
Target Start/End: Complemental strand, 49532676 - 49532591
Alignment:
| Q |
70 |
agggaaattggttttggcattttttccattcatcaatatggctgcttgatcatatgctctggctgcagcctctgctgtctcaaatg |
155 |
Q |
| |
|
||||||||| || || ||| ||| ||||||||||| || || ||||||||||||||||| ||||| || ||||| |||||||||| |
|
|
| T |
49532676 |
agggaaattagtctttgcactttgaccattcatcaaaattgcagcttgatcatatgctcttgctgctgcttctgccgtctcaaatg |
49532591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University