View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8324_1D_low_36 (Length: 221)
Name: NF8324_1D_low_36
Description: NF8324_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8324_1D_low_36 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 92; Significance: 7e-45; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 6 - 121
Target Start/End: Complemental strand, 22562764 - 22562649
Alignment:
| Q |
6 |
tctcggctgcttgaatgattttttaattgttgttgtccctcacggctattttgttctgcagcccacctataaacacttgtggtggtgggttgaagccaat |
105 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| ||||||||||| |||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
22562764 |
tctcggctgcttgaatgattttttaattggtgttgtccctggcggctattttgatctgcagcccgcctataaacacttgcggtggtgggttgaagccaat |
22562665 |
T |
|
| Q |
106 |
aaaaatttaggcgatt |
121 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
22562664 |
aaaaatttaggcgatt |
22562649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 153 - 207
Target Start/End: Complemental strand, 22562436 - 22562382
Alignment:
| Q |
153 |
ttacgtacacctctagaactaggcgtgccgccgtgtccgacatgcgttgatgtcc |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22562436 |
ttacgtacacctctagaactaggcgtgccgccgtgtccgacatgcgttgatgtcc |
22562382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University