View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8324_1D_low_37 (Length: 221)
Name: NF8324_1D_low_37
Description: NF8324_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8324_1D_low_37 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 85; Significance: 1e-40; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 103 - 199
Target Start/End: Complemental strand, 18542286 - 18542190
Alignment:
| Q |
103 |
ttcactgccatttcctcctgtgctcgatccaccttttgatcctcctttaccaccctttccttttactccatggcttgtccaacttccacccgggggt |
199 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18542286 |
ttcactaccatttcctcctgtgcctgatccaccttttgatcctcctttaccaccctttccttttactccatggcttgtccaacttccacccgggggt |
18542190 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 103 - 169
Target Start/End: Complemental strand, 18555343 - 18555277
Alignment:
| Q |
103 |
ttcactgccatttcctcctgtgctcgatccaccttttgatcctcctttaccaccctttccttttact |
169 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18555343 |
ttcaccgccatttcctcctgtgcctgatccaccttttgatcctcctttaccaccctttccttttact |
18555277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 128 - 173
Target Start/End: Complemental strand, 18550340 - 18550295
Alignment:
| Q |
128 |
gatccaccttttgatcctcctttaccaccctttccttttactccat |
173 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
18550340 |
gatccaccctttgatcctcctttaccaccatttccttttactccat |
18550295 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 28 - 92
Target Start/End: Original strand, 39656693 - 39656755
Alignment:
| Q |
28 |
agtccggtaggaccgccagcaactggctggcaatttgtagcccgcaagccctcctaataacacag |
92 |
Q |
| |
|
|||||||| |||||||||||| ||||||| ||||||||||||||||| || ||||||||||||| |
|
|
| T |
39656693 |
agtccggttggaccgccagcagctggctgacaatttgtagcccgcaaacc--cctaataacacag |
39656755 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 61; Significance: 2e-26; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 24 - 92
Target Start/End: Complemental strand, 29201040 - 29200972
Alignment:
| Q |
24 |
ggacagtccggtaggaccgccagcaactggctggcaatttgtagcccgcaagccctcctaataacacag |
92 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29201040 |
ggacagtccggtaggaccgccagcagctggctggcaatttgtagcccgcaagcccccctaataacacag |
29200972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University