View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8324_1D_low_39 (Length: 216)
Name: NF8324_1D_low_39
Description: NF8324_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8324_1D_low_39 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 92; Significance: 7e-45; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 5 - 108
Target Start/End: Complemental strand, 47705510 - 47705407
Alignment:
| Q |
5 |
ctgatatgaacctacaaggttacaagttgagctcaccaattccaagcaaagacccaaataatcgttctatacttgctttctttgctggaggggaacatgg |
104 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47705510 |
ctgaaatgaacctacaaggttacaagttgagctcaccaattccaagcaaagaatcaaataatcgttctatacttgctttctttgctggaggggaacatgg |
47705411 |
T |
|
| Q |
105 |
tatg |
108 |
Q |
| |
|
|||| |
|
|
| T |
47705410 |
tatg |
47705407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 103 - 192
Target Start/End: Complemental strand, 19149155 - 19149066
Alignment:
| Q |
103 |
ggtatgttgagagaggagatgaatgaaagagatgaaagagacagagtgaagtcaaaaaagttgaattttttattttagtgggacccacat |
192 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19149155 |
ggtatgttgagagaggaggtgaatgaaagagatgaaagagagacagtgaagtcaaaaaagttgaattttttattttagtgggacccacat |
19149066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 111 - 190
Target Start/End: Complemental strand, 19430186 - 19430103
Alignment:
| Q |
111 |
gagagaggagatgaatgaaagagatgaaagagacagagtga-----agtcaaaaaagttgaattttttattttagtgggacccac |
190 |
Q |
| |
|
|||||||||| ||||||||| ||||| |||||| ||||||| ||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
19430186 |
gagagaggaggtgaatgaaaaagatggaagagagagagtgagtgagagtcaaaaaagttgagttttt-attttagtgggacccac |
19430103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University