View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8324_1D_low_41 (Length: 212)
Name: NF8324_1D_low_41
Description: NF8324_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8324_1D_low_41 |
 |  |
|
| [»] scaffold0874 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0874 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: scaffold0874
Description:
Target: scaffold0874; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 52 - 126
Target Start/End: Complemental strand, 75 - 1
Alignment:
| Q |
52 |
ttctttctgaatccaccacgaacattcagttcactcctcccagtactcaaatgagaagaacgctccccatcatgg |
126 |
Q |
| |
|
|||||||| ||||||||||||||||||| || || ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
75 |
ttctttctcaatccaccacgaacattcaactcggtcttcctagtactcaaatgagaagaacgctccccatcatgg |
1 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University