View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8324_1D_low_41 (Length: 212)

Name: NF8324_1D_low_41
Description: NF8324_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8324_1D_low_41
NF8324_1D_low_41
[»] scaffold0874 (1 HSPs)
scaffold0874 (52-126)||(1-75)


Alignment Details
Target: scaffold0874 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: scaffold0874
Description:

Target: scaffold0874; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 52 - 126
Target Start/End: Complemental strand, 75 - 1
Alignment:
52 ttctttctgaatccaccacgaacattcagttcactcctcccagtactcaaatgagaagaacgctccccatcatgg 126  Q
    |||||||| |||||||||||||||||||  ||  || ||| ||||||||||||||||||||||||||||||||||    
75 ttctttctcaatccaccacgaacattcaactcggtcttcctagtactcaaatgagaagaacgctccccatcatgg 1  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University