View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8324_1D_low_44 (Length: 208)
Name: NF8324_1D_low_44
Description: NF8324_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8324_1D_low_44 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 41 - 202
Target Start/End: Original strand, 1769412 - 1769573
Alignment:
| Q |
41 |
ctgtgagaaaattgttacctagttttaactgagttactttagtcaatgcagatattgaactaggaattggtcctgtgaatttgtttccttgtagactaaa |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
1769412 |
ctgtgagaaaattgttacctagttttaactgagttaatttagtcaatgcagatattgaactaggaattggtcctgtgaatttgttttcttgtagactaaa |
1769511 |
T |
|
| Q |
141 |
tgcttctaattggttcatgttgcctatgttttggggtattggaccagataatgtgttattct |
202 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1769512 |
tgcttctaattggttcatgctgcctatgttttggggtattggaccagataatgtgttattct |
1769573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University