View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8324_1D_low_6 (Length: 383)
Name: NF8324_1D_low_6
Description: NF8324_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8324_1D_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 237; Significance: 1e-131; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 67 - 359
Target Start/End: Original strand, 22564031 - 22564323
Alignment:
| Q |
67 |
aaaatgtttgacttgaattcaagatctgattccccgtccgattcatcaccttcatcagtgttgttctctacatcgtcatcatcggaggcaggttgcttgc |
166 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
22564031 |
aaaatgtttgactcgaattcaagatctgattccccgtccgattcatcaccttcatcagtgttgttctctacatcgtcatcatcggaggcaggttgattgc |
22564130 |
T |
|
| Q |
167 |
tagcttgagatgtttgaatactaaggccttttggaatttttaacctaaccaccaacctgtacttttcattgtttttaccacttgtttgcagcacaccacc |
266 |
Q |
| |
|
||||||||||||||||||| | |||||||| | ||||||||||| || |||||||||| ||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
22564131 |
tagcttgagatgtttgaatgtttaggcctttagcaatttttaaccgaaaaaccaacctgttcttttcattgtttttaccacttgtttgcatcacaccacc |
22564230 |
T |
|
| Q |
267 |
ttgttcattgatcttctcatcatcatcgacattgctgcaaagtttcattcttttactgtcacggtgattcacattaagattggcagatgattg |
359 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22564231 |
ttgttcattgatcttctcatcatcatcgacactgctgcaaagtttcattcttttattgtcacggtgattcacattaagattggcagatgattg |
22564323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 255 - 336
Target Start/End: Original strand, 22573773 - 22573854
Alignment:
| Q |
255 |
cagcacaccaccttgttcattgatcttctcatcatcatcgacattgctgcaaagtttcattcttttactgtcacggtgattc |
336 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||| | ||| ||||||| || |||||| || ||| | ||| ||||||||||| |
|
|
| T |
22573773 |
cagcacaccaccttgttctttgatcttcccattcttatccacattgcggcgaagtttgatccttctcctgacacggtgattc |
22573854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University