View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8324_2D_high_1 (Length: 254)
Name: NF8324_2D_high_1
Description: NF8324_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8324_2D_high_1 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 43073828 - 43073631
Alignment:
| Q |
1 |
gaagtctgaacataaaggttgtaggatgacatggtttgatttaactttcttgattcttgaagactttggaccttgttattcgtttatttgaaccttcact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43073828 |
gaagtctgaacataaaggttgtaggatgacatggtttgatttaactttcttgattcttgaagactttggaccttgttattcgtttatttgaaccttcact |
43073729 |
T |
 |
| Q |
101 |
cttcctctttgtgtaattaactatgttactgcacctgcataggccgaaaattatggggttttccgaggtttgctggtgactgtgctaatggacacaag |
198 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43073728 |
cttactctttgtgtaattaactatgttactgcacctgcataggccgaaaattatggggttttccgaggtttgctggtgactgtgctaatggacacaag |
43073631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 192 - 237
Target Start/End: Original strand, 43074142 - 43074187
Alignment:
| Q |
192 |
acacaagtacaaaaataagcaaaacaaaagaatgcaatagaaaaat |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43074142 |
acacaagtacaaaaataagcaaaacaaaagaatgcaatagaaaaat |
43074187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University