View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8324_2D_low_10 (Length: 221)
Name: NF8324_2D_low_10
Description: NF8324_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8324_2D_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 103 - 208
Target Start/End: Complemental strand, 4725984 - 4725879
Alignment:
| Q |
103 |
atctaagttacttcttgttagtatctaagttgcgcagattgatatatgatttacatnnnnnnngaaattcatatataattgttgtgtatgtgactcaaaa |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4725984 |
atctaagttacttcttgttagtatctaagttgcgcagattgatatatgatttacataaaaaaagaaattcatatataattgttgtgtatgtgactcaaaa |
4725885 |
T |
 |
| Q |
203 |
tcttga |
208 |
Q |
| |
|
|||||| |
|
|
| T |
4725884 |
tcttga |
4725879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 18 - 121
Target Start/End: Complemental strand, 4726109 - 4726005
Alignment:
| Q |
18 |
gttgatgcgtatgaaaaaataattgtgaagaaatatcaatctttgaaatagatctaagttacttctttgtcnnnnnnnta-aataaatctaagttacttc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
4726109 |
gttgatgcgtatgaaaaaataattgtgaagaaatatcgatctttgaaatagatctaagttacttctttgtcaaaaaaatacaataaatctaagttacttc |
4726010 |
T |
 |
| Q |
117 |
ttgtt |
121 |
Q |
| |
|
||||| |
|
|
| T |
4726009 |
ttgtt |
4726005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University