View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8324_2D_low_11 (Length: 221)
Name: NF8324_2D_low_11
Description: NF8324_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8324_2D_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 1 - 178
Target Start/End: Original strand, 49689341 - 49689518
Alignment:
| Q |
1 |
aaatgttaggtatgtgttcagtggtgctgtgatgatcatgcatctaaccatttagggttttgatccaaaactattggaattggctttagaaagatgcaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49689341 |
aaatgttaggtatgtgttcagtggtgctgtgatgatcatgcatctaaccatttagggttttgatccaaaactattggaattggctttagaaagatgcaaa |
49689440 |
T |
|
| Q |
101 |
acgctagtatatacttttgaagttctttcttaaccactgagttgctagtacctgttggttatttggcggttttttcag |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
49689441 |
acgctagtatatacttttgaagttctttcttaaccactgagttgctagtacctgttgattatttggcggttttttcag |
49689518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University