View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8324_2D_low_12 (Length: 219)
Name: NF8324_2D_low_12
Description: NF8324_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8324_2D_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 10 - 217
Target Start/End: Original strand, 25622137 - 25622344
Alignment:
| Q |
10 |
tgcagcagaaccaacatgtgaacccggtgaaactggtaaacgttccgtttcagcatcacctcgcttcaactaaactgattagaaattaactttgtttccg |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25622137 |
tgcagcagaaccaacatgtgaacccggtgaaactggtaaacgttccgtttcagcatcaccttgcttcaactaaactgattagaaattaactttgtttccg |
25622236 |
T |
 |
| Q |
110 |
ataggtcgtagctcaactttattaagaaccagtatcccttttcttgtgagtgtgattagctctttcatctaatttcttcaagtggattttagatgctttt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25622237 |
ataggtcgtagctcaactttattaagaaccagtatcccttttcttgtgagtgtgattagctctttcatctaatttcttcaagtggattttagatgctttt |
25622336 |
T |
 |
| Q |
210 |
gatgtcca |
217 |
Q |
| |
|
|||||||| |
|
|
| T |
25622337 |
gatgtcca |
25622344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University