View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8324_2D_low_3 (Length: 340)
Name: NF8324_2D_low_3
Description: NF8324_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8324_2D_low_3 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 20 - 327
Target Start/End: Original strand, 15568613 - 15568919
Alignment:
| Q |
20 |
ttactcagcttggaggacctgatagtactattctttcactactctttttctttctattctcactcaccctttttgttaannnnnnnatatttggatcact |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||| ||||||||| || |||| |||| | |
|
|
| T |
15568613 |
ttactcagcttggaggacctgatagtactattctttcactactctttttctttctcttctcatgcaccttttttgtta-tttttatatgtttgaatcaat |
15568711 |
T |
 |
| Q |
120 |
actaagatatttatgatggtttcttaaaattttcagaggccactcctaaaactatcatgagggttatgggtgtgaagggtcttaccctttaccatctcaa |
219 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15568712 |
actaagatatttatgatggtttcttaaatttttcagaggccactcctaaaactatcatgagggttatgggtgtgaagggtcttaccctttaccatctcaa |
15568811 |
T |
 |
| Q |
220 |
gagccatcttcaggtttgaatacaaaaatgaaaaatagaaaatttcatttgaacttcnnnnnnnnnnnnnnctttacaacactttaatacgaactcagag |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| | |||||||| |
|
|
| T |
15568812 |
gagccatcttcaggtttgaatacaaaaatgaaaaaataaaaatttcatttgaacttcttttttgcttttttctttacaacactttaatatggactcagag |
15568911 |
T |
 |
| Q |
320 |
atcatctc |
327 |
Q |
| |
|
|||||||| |
|
|
| T |
15568912 |
atcatctc |
15568919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University