View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8324_2D_low_9 (Length: 226)
Name: NF8324_2D_low_9
Description: NF8324_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8324_2D_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 19 - 207
Target Start/End: Original strand, 53274003 - 53274189
Alignment:
| Q |
19 |
agaagttagatgaaggcatttcttgcaagcaataaatgagtgaaaaaattaagctgaaaagaaaagggagggaagaaagagtgagcatttgcaag---ta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||| || |
|
|
| T |
53274003 |
agaagttagatgaaggcatttcttgcaagcaataaatgagtgaaaaaattcagctgaaaag-----ggagggaagaaagagtgagcatttgcaagaagta |
53274097 |
T |
 |
| Q |
116 |
gctaaacttattcttcaatgtgtaccttgatgatttgtttcttcatattattgggagttgtttcttacacaactaaggctagtttggcaaca |
207 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53274098 |
gctagacttattcttcaatgtgtaccttaatgatttatttcttcatattattgggagttgtttcttacacaactaaggctagtttggcaaca |
53274189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University