View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8324_high_18 (Length: 245)
Name: NF8324_high_18
Description: NF8324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8324_high_18 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 38829856 - 38829622
Alignment:
| Q |
1 |
cgtcattactcgaccaaaataatcaatgatcgattcaccctgcttcattgctaagacctcaaagtctcggcgtagacgattaagctgtgctctcttcact |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||| |||| || ||||||||||||||| |
|
|
| T |
38829856 |
cgtcattactcgaccaaaataatcagtgattgattcaccctgcttcattgctaagacctcaaagtctcggcgtagatgattgagttgtgctctcttcact |
38829757 |
T |
|
| Q |
101 |
cgagcattgccgcgacacttcaacttcatggaatcccatagctatttagatgtctccttctgcgtgatggtcttcagaattgacttgtcaattgactgaa |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||| | |||||||||||||||||||||||| |||||| |
|
|
| T |
38829756 |
cgagcattgtcgcgacacttcaacttcatggaatcccatagccgtttagatgtctccttctgcgtgttcgtcttcagaattgacttgtcaattaactgaa |
38829657 |
T |
|
| Q |
201 |
acaagtaattcttagccttcaaatccttcagcttc |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
38829656 |
acaagtaattcttagccttcaaatccttcagcttc |
38829622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University