View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8324_low_19 (Length: 276)
Name: NF8324_low_19
Description: NF8324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8324_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 6265250 - 6265022
Alignment:
| Q |
1 |
tggcaaagagagatggaatggcttctttgtgttagtgatcatattgttgaatttaagcctacttggcaaacatttccagatggaagcaggtttgaggtac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6265250 |
tggcaaagagagatggaatggcttctttgtgttagtgatcatattgttgaattcaagcctacttggcaaacatttccagatggaagcaggtttgaggtac |
6265151 |
T |
|
| Q |
101 |
aagtataactttggaaagaattttaatgtgaacttatacaggggtatgaagtatctgtgatcattcttatataaaatataaaatcgataaatttt--cag |
198 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||| |
|
|
| T |
6265150 |
aagtataactttagaaagaattttaatgtgaacttatacaggggtatgaagtatctgtgatcattcttatataaaatataaaatcaataaatttttgcag |
6265051 |
T |
|
| Q |
199 |
tcatgtggttgatccgagtagttaatgac |
227 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
6265050 |
tcatgtggttgatccgagtagttaatgac |
6265022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 85
Target Start/End: Complemental strand, 31129851 - 31129767
Alignment:
| Q |
1 |
tggcaaagagagatggaatggcttctttgtgttagtgatcatattgttgaatttaagcctacttggcaaacatttccagatggaa |
85 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||||||| ||||||||||| | ||| |||||||||||||||| ||||||| |
|
|
| T |
31129851 |
tggcaaagagagatggaatggcttgttagtgttagtgatcacattgttgaattaataccttcttggcaaacatttcctgatggaa |
31129767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 88
Target Start/End: Complemental strand, 23782895 - 23782808
Alignment:
| Q |
1 |
tggcaaagagagatggaatggcttctttgtgttagtgatcatattgttgaatttaagcctacttggcaaacatttccagatggaagca |
88 |
Q |
| |
|
|||| |||||||||||| ||| |||||| |||||||||||||||||||||||| | ||||| |||||| || ||||| |||||||||| |
|
|
| T |
23782895 |
tggcgaagagagatggagtggtttctttctgttagtgatcatattgttgaattaacgcctaattggcagacttttcctgatggaagca |
23782808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 83
Target Start/End: Complemental strand, 34864695 - 34864613
Alignment:
| Q |
1 |
tggcaaagagagatggaatggcttctttgtgttagtgatcatattgttgaatttaagcctacttggcaaacatttccagatgg |
83 |
Q |
| |
|
||||| ||||| ||||| ||||||||||||||| ||||||| |||||||| || | |||| |||||||||||| ||||||||| |
|
|
| T |
34864695 |
tggcagagagaaatggattggcttctttgtgttggtgatcacattgttgagttaatgccttcttggcaaacatatccagatgg |
34864613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University