View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8325_high_13 (Length: 261)
Name: NF8325_high_13
Description: NF8325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8325_high_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 1 - 257
Target Start/End: Original strand, 2812778 - 2813034
Alignment:
| Q |
1 |
ccttccataagcaacaaacagttgatggagaaatgcaagaaacaaaccctgcattgagaatggtgaaccacaacttattacaaagctctccttgttcggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2812778 |
ccttccataagcaacaaacagttgatggagaaatgcaagaaacaaaccctgcattgagaatggtgaaccacaacttattacaaagctctccttgttcggt |
2812877 |
T |
 |
| Q |
101 |
tgggattctagtcgatagaggcctaaacggatccagccggttaactgcaagtcaagcatctcatcaggtggctgtgctattcttcggtggaccggatgat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2812878 |
tgggattctagtcgatagaggcctaaacggatccagccggttaactgcaagtcaagcatctcatcaggtggctgtgctattcttcggtggaccggatgat |
2812977 |
T |
 |
| Q |
201 |
agggaagcattatcctatggatggagaatgtcaaggcatccaagagttcttctcact |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
2812978 |
agggaagcattatcctatggatggagaatgtcaaggcatccaagagttcatctcact |
2813034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 90 - 231
Target Start/End: Complemental strand, 44054824 - 44054683
Alignment:
| Q |
90 |
ccttgttcggttgggattctagtcgatagaggcctaaacggatccagccggttaactgcaagtcaagcatctcatcaggtggctgtgctattcttcggtg |
189 |
Q |
| |
|
||||| ||||| || |||||||||||||||||| ||| ||| || | ||||||| | | ||||| ||| ||||| || || ||| | || || |||| |
|
|
| T |
44054824 |
ccttgctcggtcggaattctagtcgatagaggcttaagcggttcgaaccggttagcctcggatcaagtatcacatcatgtagcagtgatgttttttggtg |
44054725 |
T |
 |
| Q |
190 |
gaccggatgatagggaagcattatcctatggatggagaatgt |
231 |
Q |
| |
|
||||||| || || |||||||||| ||||||||||||||||| |
|
|
| T |
44054724 |
gaccggacgacagagaagcattatgctatggatggagaatgt |
44054683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University