View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8325_low_9 (Length: 286)
Name: NF8325_low_9
Description: NF8325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8325_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 18 - 282
Target Start/End: Original strand, 2812455 - 2812719
Alignment:
| Q |
18 |
aaatgtccctacaatagtcaatcttcttgaagcaacacacccaaataaaaggtctccaatatgtgcttatgttctccacttagtcgaactcaccggtaga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2812455 |
aaatgtccctacaatagtcaatcttcttgaagcaacacacccaaataaaaggtctccaatatgtgcttatgttctccacttagtcgaactcaccggtaga |
2812554 |
T |
 |
| Q |
118 |
gcttcggccatgcttgttgtccatgccagtggacaatcaggaggtccagcactcaacaaaacacaagcacaaactgaacacatcatcaccgcatttcaga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
2812555 |
gcttcggccatgcttgttgtccatgccagtggacaatcaggaggtccagcactcaacaaaacacaagcacaaaccgaacacatcatcaccgcatttcaga |
2812654 |
T |
 |
| Q |
218 |
atttagaggatcacgttggttacgtctcgactcaacctttgacggctgtttccccttactctacc |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2812655 |
atttagaggatcacgttggttacgtctcgactcaacctttgacggctgtttccccttactctacc |
2812719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University