View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8326_low_2 (Length: 288)
Name: NF8326_low_2
Description: NF8326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8326_low_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 37 - 271
Target Start/End: Complemental strand, 1427260 - 1427026
Alignment:
| Q |
37 |
gttgttgttcgttgattcagattgtattagatgctagctgagttaaataagtttattgttctttacaaaaattaacaaggacttattagttgttagttta |
136 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
1427260 |
gttgttgtttgttgattcagattgtattagatgctagctgagttaaataagtttactgttctttacaaaaattaataaggacttgttagttgttagttta |
1427161 |
T |
|
| Q |
137 |
gtggtgtttgtggtgaagttataccaattaccagtaagcttttgaaacaattgtgatgtaaatgtcatttctaatcaatcaaccaaatgctcatatcctt |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
1427160 |
gtggtgtttgtggtgaagttataccaattaccagtaagcttttgaaacaattgtgatgttaatgtcatttctaatcaatcaaccaaaagctcatatcctt |
1427061 |
T |
|
| Q |
237 |
acaatgttctttaccgaccacttcgtttttatata |
271 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
1427060 |
acaatgttctttaccgaccactccgtttttatata |
1427026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University