View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8326_low_3 (Length: 250)

Name: NF8326_low_3
Description: NF8326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8326_low_3
NF8326_low_3
[»] chr5 (2 HSPs)
chr5 (1-134)||(13712532-13712665)
chr5 (143-243)||(13712852-13712951)


Alignment Details
Target: chr5 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 1 - 134
Target Start/End: Original strand, 13712532 - 13712665
Alignment:
1 tgcatctgagataaacttaaaacgtactagaacttaaggactaaattgactagctccttacaatttaagtgagtagaaagatgatacaatgtaataatat 100  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13712532 tgcatctgagataaacttaaaacatactagaacttaaggactaaattgactagctccttacaatttaagtgagtagaaagatgatacaatgtaataatat 13712631  T
101 attaccgatgctgacaaaggaggatgcatgatta 134  Q
    ||||||||||||||||||||||||||||||||||    
13712632 attaccgatgctgacaaaggaggatgcatgatta 13712665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 143 - 243
Target Start/End: Original strand, 13712852 - 13712951
Alignment:
143 ttcatgaaatctaatcatatcttcagattgaactgaagatagataaagggttttgagcaaaggaagattaatagaacaatgaaacatagtggcaacacga 242  Q
    ||||||||||||  ||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
13712852 ttcatgaaatctt-tcatatcttcaaattgaactgaagatagataacgggttttgagcaaaggaagattaatagaacaatgaaacatagtggcaacacga 13712950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University