View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8327_low_2 (Length: 316)
Name: NF8327_low_2
Description: NF8327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8327_low_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 294
Target Start/End: Original strand, 32536433 - 32536707
Alignment:
| Q |
1 |
aaacaatccaactaggaccaaatctgttgtgtttagacacacaatgagatacttcttttaataataaaaataataatttgattgcacattttagagaaat |
100 |
Q |
| |
|
||||||||| |||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
32536433 |
aaacaatccgactaagaccaaatatgttgtgtttagacacacaatgagatacttcttttaataataaaaataataatttgattgcacagtttagataaat |
32536532 |
T |
 |
| Q |
101 |
gtgtctctttatgtgtagacagtctagatctcgtgtgaccatacaagactattgcataccggcaagtgtccaatgcaatacttagtaggtttgtcttgac |
200 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32536533 |
gtgtctctttatgtgtagacactctagatctcgtgtgaccatacaagactattgcataccggcaagtgtccaatgcaatacttagtaggtttgtcttgac |
32536632 |
T |
 |
| Q |
201 |
tttagcttaaaaataaaagtattagatagtttaaaaataataaatttttgcttgtaataatagtcttgtctcttataatttggtttaggggaag |
294 |
Q |
| |
|
|||||| |||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
32536633 |
attagctaaaaa-------------------taaaaataataaatttttgcttgtaatagtagtcttgtctcttataatttggtttagaggaag |
32536707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University