View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8327_low_4 (Length: 243)
Name: NF8327_low_4
Description: NF8327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8327_low_4 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 6 - 243
Target Start/End: Complemental strand, 52625608 - 52625371
Alignment:
| Q |
6 |
gagagggagagatgttgtttcaggtgggcggacaaggtagtcgtccgacgttcttcgagatggcggcggcagaacagcttccacgtagtctccgtgcggc |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52625608 |
gagagggagagatgttgtttcaggtgggcggacaaggtagtcgtccgacgttcttcgagatggcggcggcagaacagcttccacgtagtctccgtgcggc |
52625509 |
T |
 |
| Q |
106 |
gctgacatactcaatcggagtattagcattaagaacacctttccttcataaattattagattacgaacacgaatctttctcattactcatgctcgttctc |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52625508 |
gctgacatactcaatcggagtattagcattaagaacacctttccttcataaattattagattacgaacacgaatctttctcattactcatgctcgttctt |
52625409 |
T |
 |
| Q |
206 |
gaagctcacagtttacgaaccaccgatgcttctttttc |
243 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
52625408 |
gaagctcacagtttacgaaccactgatgcttctttttc |
52625371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University