View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8327_low_5 (Length: 240)
Name: NF8327_low_5
Description: NF8327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8327_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 52625291 - 52625068
Alignment:
| Q |
1 |
ttacgccgacgccaaaagcttctttctcttctctttttggtaccaattccctaaccctaaaaactacttttagcttatttcaaacttataagtgcttaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
52625291 |
ttacgccgacgccaaaagcttctttctcttctctttttggtaccaattccctaaccctaaaaactacttttagcttatgtcaaacttattagtgcttaat |
52625192 |
T |
|
| Q |
101 |
taattaagatttctgttttaaggttgtgttgccgtatctgaaatcgaagctacattcaatctacaataaagaaagggaagcaagaattcaggccactctt |
200 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
52625191 |
taattaagatttctgttttaaggttgttttgccgtatctgaaatcgaagctgcattcaatctacaataaagaaagggaagcaagaattcaggccactatt |
52625092 |
T |
|
| Q |
201 |
tggggagatgaaaatgaatcatat |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
52625091 |
tggggagatgaaaatgaatcatat |
52625068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University