View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8328_low_1 (Length: 451)
Name: NF8328_low_1
Description: NF8328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8328_low_1 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 156; Significance: 1e-82; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 156; E-Value: 1e-82
Query Start/End: Original strand, 247 - 430
Target Start/End: Complemental strand, 35520804 - 35520621
Alignment:
| Q |
247 |
ttttgggacaatggcttctcttgtaatgattcttagcacaaatcaatgacttcaatggttgaaacttgacatgcttttggttccatctacacccttcttg |
346 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||| |||| |
|
|
| T |
35520804 |
ttttgggacaatgacttctcttgtaatgattcttagcacaaatcaatgacttcaatggttgaaacttggcatgtttttggttccatctacaccctgcttg |
35520705 |
T |
|
| Q |
347 |
aggacatgaacatttcttatttttcatactcatcaaataatctctattcttattaattggattgctcaatgctacactactctt |
430 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
35520704 |
aggacatgaatatttcctatttttcatactcatcaaataatctctattcttattaattggattgctcaatgctgcactactctt |
35520621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 1 - 71
Target Start/End: Complemental strand, 35522883 - 35522813
Alignment:
| Q |
1 |
agttggaccttccgatgttcgccggttcactttgcatcttacaattgtcacggagatataattagacatat |
71 |
Q |
| |
|
||||||||||||||||| ||| | |||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
35522883 |
agttggaccttccgatgctcgtcagttcactttgtatcttacaattgtcgtggagatataattagacatat |
35522813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 26 - 66
Target Start/End: Complemental strand, 35525812 - 35525772
Alignment:
| Q |
26 |
ttcactttgcatcttacaattgtcacggagatataattaga |
66 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
35525812 |
ttcactttgcatcttacaattgtcgtggagatataactaga |
35525772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 29683326 - 29683278
Alignment:
| Q |
1 |
agttggaccttccgatgttcgccggttcactttgcatcttacaattgtc |
49 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||||||| ||||||| |
|
|
| T |
29683326 |
agttggaccttccgatgctcgtcggttcactttgcatcttagaattgtc |
29683278 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University