View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8330_high_14 (Length: 236)
Name: NF8330_high_14
Description: NF8330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8330_high_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 18110193 - 18109972
Alignment:
| Q |
1 |
ttcttcttgacccttttgagtcttttcatctatttggtcattggttgtgtctttagatgttggttttggctcaaattcttgttgacccttttgaggaatt |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18110193 |
ttcttcttgacccttttgagacttttcatctatttggtcattggttgtgtctttagatgttggttttggctcaaattcttgttgacccttttgaggaatt |
18110094 |
T |
 |
| Q |
101 |
tgagatgatgtgtcatcatcattttgtgtcnnnnnnncaatgctttgagaagtttgaggtgaatcacttttcatgtctttggttgattcttccaaattag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
18110093 |
tgagatgatgtgtcatcatcattttgtgtctttttttcaatgctttgagaagtttgaggtgaatcacttttcatgtctttagttgattcttccaaattag |
18109994 |
T |
 |
| Q |
201 |
tagattgtggtgatggaatatt |
222 |
Q |
| |
|
|||||||||||| ||||||||| |
|
|
| T |
18109993 |
tagattgtggtggtggaatatt |
18109972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 5 - 96
Target Start/End: Complemental strand, 18110339 - 18110248
Alignment:
| Q |
5 |
tcttgacccttttgagtcttttcatctatttggtcattggttgtgtctttagatgttggttttggctcaaattcttgttgacccttttgagg |
96 |
Q |
| |
|
|||| ||||||||||| |||||||| | |||| | |||||| | ||| ||||||||||||||| ||| || |||||||||| |||||||| |
|
|
| T |
18110339 |
tcttcacccttttgagccttttcatttgtttgtgctttggttctctctatagatgttggttttgactccaacacttgttgaccattttgagg |
18110248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University